Albinism, in general, is a rare group of genetic disorders. These disorders cause one's skin, hair, or eyes to have little to no color. Problems with vision may also occur. People affected by albinism have to take special care of themselves in the sun by using sunscreen because of a heightened risk of skin cancer.
There are two types of albinism, the kind that affects the body's appearance (skin, hair, eyes) is called Oculocutaneous Albinism, and the kind that affects the eyes is called Ocular Albinism. Both types are known to cause poor eyesight.
Albinism has been found to occur in about 1 in every 20,000 people.
Genetics & Proteins
The human body is formed from the combined genetic code, or DNA (deoxyribonucleic acid), from both parents. Of course, the body is made of cells, but these cells are constructed using the instructions found inside every living organism, and that is the DNA: a double helix made up of nucleotides.
DNA in any organism is used to reproduce, and is used in the synthesis of proteins. Proteins are an important part of every cell; the shape of the protein determines it's function as an enzyme. Proteins are defined by their chemical composition, and enzymes are defined by their function. An example of an enzyme is Amylase, which breaks down starches and carbohydrates into sugars for use as energy.
Transcription
Individual strands of DNA, called genes, code for both amino acids and the traits of an organism (a person's trait is identified as their genotype, and it's physical appearance is called the phenotype). However, they are not directly read from the nucleus, which is the location of the DNA. The gene is split from its complementary half and copied by the RNA (Ribonucleic Acid) enzyme polymerase in a process called transcription.
The polymerase attaches to the beginning, which is determined by a specific sequence of bases (a nucleotide is made up of two complementary bases, it is the nucleotides that make up DNA's structure). The polymerase does not just copy each base to make a new strand: for each base the polymerase spits out its corresponding complementary base. These base pairs are determined by what are called —surprisingly—the base pairing rules. The rules dictate that the base Guanine (G) always pairs with Cytosine (C), and Adenine (A) with Thymine (T, in DNA) or Uracil (U, in RNA).
The polymerase is manufacturing what is called Messenger Ribonucleic Acid (mRNA), so base U complements A. Once the polymerase reaches the end of the gene, it stops and the mRNA is released to exit the nucleus. Once in the cytoplasm, the mRNA is distributed among ribosomes which actually create the proteins.
Translation
Now at a ribosome, the mRNA is attached and read in a process called translation. The mRNA contains the final instructions that actually correspond to amino acids. Amino acids are the "building blocks" of proteins. There are 21 types of amino acid, and which ones are used in what order is determined by the instructions in the mRNA.
The mRNA is read three bases at a time, in what are called codons. Each codon corresponds to an amino acid, except for the ones that represent the beginning (usually AUG) of the molecule to be read, and the end. The ribosome puts together the actual structure of the protein by using Transfer RNA (tRNA). Each tRNA molecule has an amino acid attached to its head, and at its bottom is what is called an anticodon. The anticodon is complementary to specific codons. Therefore, the the tRNA lays down the amino acids based on each codon in the right order.
Mutation
Mutations are changes in DNA. They may occur during the reproduction of cells, or due to environmental factors. Many are familiar with those environmental factors. A big one is radiation, which damages the DNA while in the nucleus, and this can create a cascade of issues for relatively obvious reasons.
The change of one base can end up changing an entire amino acid, and that one amino acid is critical in deciding the function of the enzyme. If an amino acid is changed, it can alter the function of an enzyme or, in most cases, make it completely dysfunctional. That can result in serious medical issues. Luckily, there are far too many permutations of codons (64) for the number of amino acids that exist (21). This results in multiple codons corresponding to the same amino acid. So, if a mutation does occur, this may not change anything about the resulting proteins and traits, due to redundancy in the cell-building instructions.
Heredity
Heredity is the passing on of traits through generations. Everybody's DNA is inherited from their parents. It would be useful to have more background on how DNA is replicated during cell reproduction before moving on. There are two types of division in cells, mitosis and meiosis. Mitosis is where a cell divided to create two identical daughter cells, and meiosis is where the mother cell divides twice to create 4 daughter cells, each with unique DNA and half the chromosomes (haploid). Mitosis is the main type of cell division, but meiosis is used to produce sex cells, called gametes.
When the cell begins mitosis, the DNA condenses into 23 chromosomes. Those chromosomes duplicate because they will be pulled apart into two separate cells later on. They carry all of your genetic information. When copied (diploid), there are 46 total chromosomes. During mitosis, the homologous pairs line up and are then pulled away from each other, one for each cell.
Everybody has traits, traits are what makes up everyone's features. Examples of traits include hair color, height, and skin color. These traits are defined by DNA, more specifically genes. Each gene applies to a trait, and the way it is expressed corresponds to, for example, a certain color of hair. For hair color, it takes two genes to decide hair. An allele is one form of a gene that is expressed on a chromosome.
For every trait there is a genotype. The genotype is made up of the DNA inherited from both parents. Each parent provides an allele, and the genotype is made up of those alleles. When couples have offspring, those genotypes are combined, but only a part of the genotype from each parent can make it through. It works kind of like multiplying with an area model, as shown in this illustration. The alleles are chosen randomly, and that makes for four options for the offpsring.
Alleles can have a dominant (X) or recessive (x) variation. Dominant alleles always overpower recessive, even if there is just one dominant allele. If a trait is dominant, that means the genotype must be either XX (homozygous) or Xx (heterozygous) for the dominant feature to show (say your hair is blue if the the trait is expressed). Or, if the trait is recessive, the genotype must be xx (homozygous). In that case, if the genotype is Xx, that person is considered a carrier. The trait will not be expressed, but they will still be carrying one allele that can be passed down to be expressed in future generations.
Here is a picture of two well-known American musicians (Johnny and Edgar Winter) with their parents. Both sons are albinos, but neither parent is. Therefore, each parent must be a heterozygous carrier of the albinism gene. The probability of one son being albino was 25%. The probability of both (non-twin) sons being albino was 1/4 * 1/4 = 1/16, or 6%.
Johnny and Edgar Winter - Family Archives
How does albinism occur?
The trait is caused by a defect in multiple genes responsible for producing and distributing melanin. Remember that defects can stop things from working, and that is what usually happens with albinism. The defects slow or stop melanin production. Those defects are passed down recessively through generations, so a parent must at least be a carrier of the trait to have an albino offspring.
For this type of albinism, the cause comes from mutations in the OCA2 gene. Multiple mutations may cause type 2 albinism because the cause in the end is the inability to produce melanin. 154 different mutations have been detected in the OCA2 gene causing albinism.
The most common mutation for this type of albinism is a large deletion. This is where a chunk of the gene is removed. Routinely, enzymes in the nucleus run over the DNA to check for mutations, because they may be able to fix them (for instance if one side is intact but doesn't match up with the other the enzyme can change a base). After this deletion mutation, when the enzyme sees the DNA missing, it will bring together the two ends of the gap instead of trying to fill it. Now there are many issues with that segment.
Here is what a sequence may look like:
ACGTACTAGCTAGCTTAAGTCCCATC
TGCATGATCGATCGAATTCAGGGTAG
ACGTACTAGCTAGCTTAAGTCCCATC
TGCATGATCGAATTCAGGGTAG
The sequence of amino acids changing looks like this:
GKLWQLLALS PLENYSVNLS SHVDSTLLQV DLAGALVASG PSRPGREEHI
What are the treatments for albinism?
Treatments neither exist nor is there an immediate need to. Albinism is not fatal or immediately dangerous. There are, however, methods to protect against the risks that come with albinism. It is recommended to wear sunglasses, hats, and sunscreen outside due to more sensitive skin and eyes.
This models how albinism can be passed on through generations. If it were a dominant disorder, it would look much different.